crisprSQL

Database for CRISPR/Sp-Cas9 off-target assays

Guides

This table shows all guide RNAs with at least two measured off-targets. It can be reordered by clicking on a column title.

Clicking on a guide sequence shows all measured off-targets for the respective guide.

Human

No. sequence region gene ID assembly cell line study target distribution measured off-targets
1
AATGACCACTACATCCTCAAGGG
chr1:131892774-131892796hg19K562Cho offtarget distribution5
2
GTCATCTTAGTCATTACCTGAGG
chr1:185056767-185056789RNF2hg19K562Tsai_circle offtarget distribution34
3
— " —
— " —
RNF2hg19U2OSTsai_circle offtarget distribution331
4
CTCGTCTGATAAGACAACAGTGG
chr1:198639112-198639134PTPRChg38HEK293Cameron offtarget distribution156
5
GCAAAACTCAACCCTACCCCAGG
chr1:198699665-198699687PTPRChg38HEK293Cameron offtarget distribution204
6
ATAGGAGAAGATGATGTATAGGG
chr1:207898989-207899011CD34hg38HEK293Cameron offtarget distribution178
7
GTCATCTTAGTCATTACCTGAGG
chr1:185056773-185056795RNF2hg19HeLaKimChromatin offtarget distribution3
8
— " —
— " —
RNF2hg19HeLaKim16 offtarget distribution12
9
GGCCTCCCCAAAGCCTGGCCAGG
chr2:73161171-73161193EMX1hg19HEK293Ran offtarget distribution13
10
GGCCAGGCTTTGGGGAGGCCTGG
chr2:73161174-73161196EMX1hg19HEK293Ran offtarget distribution17
11
GGCCTCCCCAAAGCCTGGCCAGG
chr2:73161171-73161193EMX1hg19HEK293Ran offtarget distribution11
12
GGCCAGGCTTTGGGGAGGCCGG
chr2:73161174-73161193EMX1hg19HEK293Ran offtarget distribution8
13
GAGTCCGAGCAGAAGAAGAAGGG
chr2:73160981-73161004EMX1hg19U2OSTsai offtarget distribution27
14
— " —
— " —
EMX1hg19U2OSTsai offtarget distribution3
15
— " —
— " —
EMX1hg19K562Tsai_circle offtarget distribution157
16
— " —
— " —
EMX1hg19U2OSTsai_circle offtarget distribution125
17
— " —
— " —
EMX1hg19U2OSTsai_circle offtarget distribution100
18
GGTGGACAAGCGGCAGATAGCGG
chr2:216109346-216109368XRCC5hg38HEK293Cameron offtarget distribution178
19
GAGTCCGAGCAGAAGAAGAAGGG
chr2:73160999-73161021EMX1hg19HeLaKimChromatin offtarget distribution14
20
— " —
— " —
EMX1hg19HEK293Frock offtarget distribution13
21
— " —
— " —
EMX1hg19HeLaKim16 offtarget distribution27
22
— " —
— " —
HCN1hg19U2OSKleinstiver offtarget distribution6
23
GCAGCCAGTACAGCTCACCAAGG
chr2:113832869-113832891CSRNP3hg19U2OSKleinstiver offtarget distribution9
24
GAGTCCGAGCAGAAGAAGAAGGG
chr2:73160982-73161004EMX1hg19U2OSListgarten offtarget distribution8
25
GTCACCTCCAATGACTAGGGTGG
chr2:73161066-73161088EMX1hg19U2OSListgarten offtarget distribution10
26
GAGTCCGAGCAGAAGAAGAAGGG
chr2:73160997-73161019EMX1hg19HEK293Slaymaker offtarget distribution4
27
TGACATCAATTATTATACATCGG
chr3:46414423-46414445RP11-24F11.2hg19K562Cho offtarget distribution13
28
GAATCCTAAAAACTCTGCTTCGG
chr3:46415040-46415062RP11-24F11.2hg19K562Cho offtarget distribution13
29
GACACCGAAGCAGAGTTTTTAGG
chr3:46415044-46415066RP11-24F11.2hg19K562Cho offtarget distribution9
30
GGTCCTGCCGCTGCTTGTCATGG
chr3:46415002-46415024RP11-24F11.2hg19K562Cho offtarget distribution13
31
AAATGAGAAGAAGAGGCACAGGG
chr3:46415068-46415090RP11-24F11.2hg19K562Cho offtarget distribution13
32
CCTGCCTCCGCTCTACTCACTGG
chr3:46414489-46414511RP11-24F11.2hg19K562Cho offtarget distribution11
33
ATGAACACCAGTGAGTAGAGCGG
chr3:46414496-46414518RP11-24F11.2hg19K562Cho offtarget distribution12
34
AACACCAGTGAGTAGAGCGGAGG
chr3:46414493-46414515RP11-24F11.2hg19K562Cho offtarget distribution6
35
CCAGTGAGTAGAGCGGAGGCAGG
chr3:46414489-46414511RP11-24F11.2hg19K562Cho offtarget distribution11
36
GAACACAAAGCATAGACTGCGGG
chr5:87240596-87240619hg19HEK293Tsai offtarget distribution2
37
— " —
— " —
hg19HEK293Tsai_circle offtarget distribution47
38
— " —
— " —
hg19K562Tsai_circle offtarget distribution319
39
— " —
— " —
hg19HeLaKimChromatin offtarget distribution2
40
— " —
— " —
hg19HeLaKim16 offtarget distribution17
41
GATGATGATGCCCCGGGCGTTGG
chr5:178418448-178418470GRM6hg19U2OSKleinstiver offtarget distribution7
42
GGGTGGGGGGAGTTTGCTCCTGG
chr6:43737291-43737313FOXJ3hg19HAP1Kim offtarget distribution85
43
— " —
— " —
IGDCC3hg19U2OSTsai offtarget distribution35
44
GACCCCCTCCACCCCGCCTCCGG
chr6:43738555-43738578PAPD7hg19U2OSTsai offtarget distribution223
45
GGTGAGTGAGTGTGTGCGTGTGG
chr6:43737453-43737476MAXhg19U2OSTsai offtarget distribution83
46
GTGGGGGGAGTTTGCTCCTGG
chr6:43737290-43737311KRT42Phg19U2OSTsai offtarget distribution9
47
GTGAGTGAGTGTGTGCGTGTGGG
chr6:43737455-43737477hg19U2OSTsai offtarget distribution15
48
GACCCCCTCCACCCCGCCTCCGG
chr6:43738556-43738578VEGFAhg19U2OSTsai_circle offtarget distribution2213
49
GGTGAGTGAGTGTGTGCGTGTGG
chr6:43737454-43737476hg19U2OSTsai_circle offtarget distribution1217
50
GGGTGGGGGGAGTTTGCTCCTGG
chr6:43737291-43737313hg19U2OSTsai_circle offtarget distribution496
51
— " —
— " —
hg19U2OSTsai_circle offtarget distribution407
52
— " —
— " —
hg38HEK293Cameron offtarget distribution422
53
GGGTGGGGGGAGTTTGCTCCAGG
chr6:43737297-43737319hg19HeLaKimChromatin offtarget distribution30
54
GGGTGGGGGGAGTTTGCTCCTGG
chr6:43737291-43737313hg19HEK293Frock offtarget distribution38
55
GGGTGGGGGGAGTTTGCTCCAGG
chr6:43737294-43737313hg19HeLaKim16 offtarget distribution36
56
GACCCCCTCCACCCCGCCTCCGG
chr6:43738556-43738578VEGFAhg19HeLaKim16 offtarget distribution29
57
GGTGAGTGAGTGTGTGCGTGTGG
chr6:43737454-43737476hg19HeLaKim16 offtarget distribution45
58
GATGGTAGATGGAGACTCAGGGG
chr6:41309631-41309653NCR2hg19U2OSKleinstiver offtarget distribution19
59
GACCCCCTCCACCCCGCCTCCGG
chr6:43738556-43738578HDLBPhg19U2OSListgarten offtarget distribution21
60
GGTGAGTGAGTGTGTGCGTGTGG
chr6:43737454-43737476hg19U2OSListgarten offtarget distribution32
61
GACCCCCTCCACCCCGCCTCCGG
chr6:43738556-43738578HDLBPhg19U2OSListgarten offtarget distribution144
62
— " —
— " —
PAPD7hg19U2OSChen17 offtarget distribution134
63
GGTGAGTGAGTGTGTGCGTGTGG
chr6:43737453-43737476hg19U2OSChen17 offtarget distribution12
64
— " —
— " —
hg19HEK293Slaymaker offtarget distribution12
65
— " —
— " —
hg19HEK293Slaymaker offtarget distribution12
66
GGGAAAGACCCAGCATCCGTGGG
chr9:110103687-110103710hg19HEK293Tsai offtarget distribution9
67
GGCCCAGACTGAGCACGTGATGG
chr9:110184619-110184642RP11-363D24.1hg19HEK293Tsai offtarget distribution5
68
GGGAAAGACCCAGCATCCGTGGG
chr9:110103688-110103710NTF3hg19HEK293Tsai_circle offtarget distribution50
69
GGCCCAGACTGAGCACGTGATGG
chr9:110184620-110184642RP11-363D24.1hg19HEK293Tsai_circle offtarget distribution113
70
GGGAAAGACCCAGCATCCGTGGG
chr9:110103688-110103710hg19K562Tsai_circle offtarget distribution119
71
GGCCCAGACTGAGCACGTGATGG
chr9:110184620-110184642RP11-363D24.1hg19K562Tsai_circle offtarget distribution125
72
— " —
— " —
RP11-363D24.1hg19HeLaKimChromatin offtarget distribution5
73
GGGAAAGACCCAGCATCCGTGGG
chr9:110103688-110103710hg19HeLaKim16 offtarget distribution10
74
GGCCCAGACTGAGCACGTGATGG
chr9:110184620-110184642RP11-363D24.1hg19HeLaKim16 offtarget distribution19
75
GCATACAGTGATTTGATGAAAGG
chr10:87746680-87746702PAPSS2hg38HEK293Cameron offtarget distribution182
76
CTTGCCCCACAGGGCAGTAACGG
chr11:5248198-5248220HBBhg19HAP1Kim offtarget distribution75
77
GGAATCCCTTCTGCAGCACCTGG
chr11:22647331-22647354FANCFhg19U2OSTsai offtarget distribution17
78
— " —
— " —
FANCFhg19K562Tsai_circle offtarget distribution395
79
— " —
— " —
FANCFhg19U2OSTsai_circle offtarget distribution65
80
— " —
— " —
FANCFhg38HEK293Cameron offtarget distribution175
81
GCTGATGTAGTCACTCTTGAGGG
chr11:836294-836316CD151hg38HEK293Cameron offtarget distribution127
82
CTTGCCCCACAGGGCAGTAACGG
chr11:5248215-5248237HBBhg19HeLaKimChromatin offtarget distribution43
83
GGAATCCCTTCTGCAGCACCTGG
chr11:22647338-22647360FANCFhg19HeLaKimChromatin offtarget distribution35
84
GCCTCTTTCCCACCCACCTTGGG
chr11:36594861-36594883RAG1hg19HEK293Frock offtarget distribution33
85
GGAATCCCTTCTGCAGCACCTGG
chr11:22647332-22647354FANCFhg19HeLaKim16 offtarget distribution15
86
GCTGCTGCTCTGGTTCCTCGTGG
chr11:3685362-3685384ART1hg19U2OSKleinstiver offtarget distribution3
87
GGAATCCCTTCTGCAGCACCTGG
chr11:22647332-22647354FANCFhg19U2OSListgarten offtarget distribution4
88
GCTGCAGAAGGGATTCCATGAGG
chr11:22647338-22647360FANCFhg19U2OSListgarten offtarget distribution25
89
GGCGGCTGCACAACCAGTGGAGG
chr11:22647156-22647178FANCFhg19U2OSListgarten offtarget distribution8
90
GCTGCAGAAGGGATTCCATGAGG
chr11:22647337-22647360FANCFhg19U2OSChen17 offtarget distribution10
91
GCTTGAGACCGCCAGAAGCTCGG
chr11:22647299-22647322RP11-735B13.1hg19U2OSChen17 offtarget distribution34
92
GTGCGGCAAGAGCTTCAGCCGGG
chr15:85165028-85165050RP11-182J1.18hg19U2OSListgarten offtarget distribution8
93
GCTAGAGTCACAAGTCCCACCGG
chr17:39197443-39197465KRTAP1-1hg19U2OSKleinstiver offtarget distribution3
94
GGAGTGAGGGAAACGGCCCCAGG
chr19:10244631-10244654MYH9hg19U2OSChen17 offtarget distribution8
95
GGCACTGCGGCTGGAGGTGGGGG
chr20:31349755-31349778CDH4hg19HEK293Tsai offtarget distribution133
96
— " —
— " —
hg19HEK293Tsai_circle offtarget distribution1043
97
— " —
— " —
hg19HeLaKim16 offtarget distribution38
98
GCATTTTCAGGAGGAAGCGATGG
chr21:36421193-36421215RUNX1hg19U2OSListgarten offtarget distribution2
99
TGGATGGAGGAATGAGGAGTTGG
chrX:48544569-48544591WAShg19HEK293Wang offtarget distribution10
100
GCCGGAGGGGTTTGCACAGAAGG
chrX:104464363-104464385DYSFhg19U2OSKleinstiver offtarget distribution7
101
GACGCATAAAGATGAGACGCTGG
n/aFinkelstein offtarget distribution7053
102
GTGATAAGTGGAATGCCATGTGG
n/aFinkelstein offtarget distribution7053

Rodents

No. sequence region gene ID assembly cell line study target distribution measured off-targets
1
CATGTGATCGCGCTTCTCGTTGG
n/amm10embryoAnderson offtarget distribution15
2
TCTGCAGTCGACGGTACCGCGGG
n/amm10embryoAnderson offtarget distribution15
3
TTGATGGCCCATCTACCTCCAGG
chr1:58752658-58752680Cflarmm10embryoAnderson offtarget distribution15
4
AGGTACCCTGGTCATTCACTTGG
chr1:94052455-94052477Pdcd1mm10embryoAnderson offtarget distribution11
5
CGCCAGGAACTCACACTTCATGG
chr2:128779864-128779886Mertkmm10embryoAnderson offtarget distribution15
6
TGGTCATCCGCAAGCGGAAAGTGG
chr2:26359364-26359387Card9mm10embryoAnderson offtarget distribution5
7
CCGGAATAGCACCGTGCCACAGG
chr2:26360157-26360179Card9mm10embryoAnderson offtarget distribution11
8
CATTGAATAAGGCGCCCTGCAGG
chr2:26359069-26359091Card9mm10embryoAnderson offtarget distribution11
9
AAAGATGCCCGCTATACCAACGG
chr3:88629817-88629839Arhgef2mm10embryoAnderson offtarget distribution11
10
CACCGCAGCCACGCAGAGCAGG
chr4:106136484-106136504"Pcsk9"mm9N2ARan offtarget distribution14
11
GGCCGCTGACCACACCTGCCAGG
chr4:106126920-106126942"Pcsk9"mm9N2ARan offtarget distribution18
12
AAGGTACACCACGTACCAGTAGG
chr5:3806082-3806104rn5embryoAnderson offtarget distribution12
13
AAAGGTGTGGCGCTGCTGAAGGG
chr6:4753911-4753933Peg10mm10embryoAnderson offtarget distribution15
14
GGTGGGTATGGGAACACGTTTGG
chr6:4760659-4760681mm10embryoAnderson offtarget distribution15
15
TGGAAAGCAAAATCATGGCTTGG
chr7:48552843-48552865Mrgprb2mm10embryoAnderson offtarget distribution11
16
AGAGAGACAGCTTGCAAACTAGG
chr8:85071578-85071600mm10embryoAnderson offtarget distribution11
17
ATCATTGTGCAGGCCTGCAGAGG
chr9:5324934-5324956Casp4mm10embryoAnderson offtarget distribution11
18
GGAGATGTGGATCTCCGCACTGG
chr10:38767111-38767133rn5embryoAnderson offtarget distribution11
19
AGAAGGAGTTCGCCAAAGCCAAGG
chr10:91098294-91098317rn5embryoAnderson offtarget distribution11
20
TGAGGTGAGGCACTTCTAACAGG
chr11:98626203-98626225mm10embryoAnderson offtarget distribution15
21
AGGTAGGGGGTGAGCCGGCTAGG
chr11:119317211-119317233Card14mm10embryoAnderson offtarget distribution5
22
TGGGATCCGAAGCACTCTTCTGG
chr12:33111533-33111555rn5embryoAnderson offtarget distribution17
23
ACCATGGAAGGGGATAGGCGAGG
chr14:65971305-65971327Clumm10embryoAnderson offtarget distribution15
24
TATTGGTGTGGTGCCTAATTTGG
chr14:30006934-30006956Il17rbmm10embryoAnderson offtarget distribution15
25
ATCTATAATCATGCCTACCGTGG
chr14:30005718-30005740Actr8mm10embryoAnderson offtarget distribution15
26
GCAGGGTGCGAGTGATCCAAGGG
chr15:63857461-63857483mm10embryoAnderson offtarget distribution15
27
GGGATTAGGCCAGAGAAGAGGGG
chr15:84172740-84172762Pnpla3mm10embryoAnderson offtarget distribution15
28
ACTAGGCCCCAGTACTTCACTGG
chr15:66906169-66906191Ccn4mm10embryoAnderson offtarget distribution15
29
TTTGGTGGCTTTCGTCAATGTGG
chr15:77050721-77050743Apol6mm10embryoAnderson offtarget distribution12
30
TAGAGTCCGGATCTTGTTGGAGG
chr15:5108286-5108308Card6mm10embryoAnderson offtarget distribution5
31
AAAGAGGAACATCTCTGCAGAGG
chr16:43662258-43662280Tigitmm10embryoAnderson offtarget distribution15
32
GTTCTGAGCCCTGGTACCCCTGG
chr17:34914321-34914343mm10embryoAnderson offtarget distribution15
33
ACGTCTACTGAAATTGACCCTGG
chr19:56433105-56433127Casp7mm10embryoAnderson offtarget distribution15

crisprSQL is developed at Oxford University, 2020